ID: 1141598299_1141598302

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1141598299 1141598302
Species Human (GRCh38) Human (GRCh38)
Location 16:85110647-85110669 16:85110663-85110685
Sequence CCTGGGCTGGTCAGTAGTGGGCA GTGGGCAGGAATATAAATGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 254} {0: 1, 1: 0, 2: 0, 3: 12, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!