ID: 1141604403_1141604407

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1141604403 1141604407
Species Human (GRCh38) Human (GRCh38)
Location 16:85144715-85144737 16:85144745-85144767
Sequence CCTGCTTCTGCAGGTCAGAAGTC GCTCTCACTGGGCCAAAATCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 12, 3: 46, 4: 307} {0: 1, 1: 0, 2: 9, 3: 52, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!