ID: 1141611259_1141611265

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1141611259 1141611265
Species Human (GRCh38) Human (GRCh38)
Location 16:85182322-85182344 16:85182336-85182358
Sequence CCAAGAAACCAGGCAGGCTCCAG AGGCTCCAGAGGATGGGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 385} {0: 1, 1: 0, 2: 8, 3: 60, 4: 552}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!