ID: 1141705410_1141705418

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1141705410 1141705418
Species Human (GRCh38) Human (GRCh38)
Location 16:85661851-85661873 16:85661872-85661894
Sequence CCGTCCACTCCTGCTTTTTGCCT CTGGGGTAGTCCCAGGCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 44, 4: 616} {0: 1, 1: 0, 2: 7, 3: 55, 4: 368}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!