ID: 1141743813_1141743820

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1141743813 1141743820
Species Human (GRCh38) Human (GRCh38)
Location 16:85912775-85912797 16:85912826-85912848
Sequence CCAGCATCACTGTTCACTGGTGT TTGAGGGCAATTGGATAATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 177} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!