ID: 1141842438_1141842442

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1141842438 1141842442
Species Human (GRCh38) Human (GRCh38)
Location 16:86581905-86581927 16:86581946-86581968
Sequence CCGTATTGAATCGGTTTTTAATC TGTTTGTATGTTATCTTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 110} {0: 1, 1: 0, 2: 0, 3: 19, 4: 335}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!