ID: 1141919423_1141919425

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1141919423 1141919425
Species Human (GRCh38) Human (GRCh38)
Location 16:87126072-87126094 16:87126088-87126110
Sequence CCTCGTCGGAATAAGGCAGCTGC CAGCTGCCCCTCTGCCGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 36} {0: 1, 1: 0, 2: 5, 3: 28, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!