ID: 1141989642_1141989654

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1141989642 1141989654
Species Human (GRCh38) Human (GRCh38)
Location 16:87602671-87602693 16:87602699-87602721
Sequence CCCGCGGGCCCCGCCGCCGCCCT GCCCGCAGCGCGGCAGCCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 116, 4: 790} {0: 1, 1: 0, 2: 2, 3: 29, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!