ID: 1141992506_1141992512

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1141992506 1141992512
Species Human (GRCh38) Human (GRCh38)
Location 16:87618574-87618596 16:87618602-87618624
Sequence CCTTTTTCCACCTGGCCACACTG TCGTTCCCGCCAGCAGCATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 344} {0: 1, 1: 0, 2: 0, 3: 12, 4: 63}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!