ID: 1141994953_1141994959

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1141994953 1141994959
Species Human (GRCh38) Human (GRCh38)
Location 16:87630421-87630443 16:87630435-87630457
Sequence CCCCTTCCTGGCATTCCCCAGCC TCCCCAGCCAGTCCTCCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 55, 4: 656} {0: 1, 1: 0, 2: 7, 3: 39, 4: 411}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!