ID: 1142000416_1142000424

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1142000416 1142000424
Species Human (GRCh38) Human (GRCh38)
Location 16:87661160-87661182 16:87661203-87661225
Sequence CCACCTTCAGAGCCAGCGGGGCA CCTCCTGCCTCCCTCTTACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 224} {0: 4, 1: 41, 2: 126, 3: 365, 4: 895}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!