ID: 1142003778_1142003785

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1142003778 1142003785
Species Human (GRCh38) Human (GRCh38)
Location 16:87679598-87679620 16:87679611-87679633
Sequence CCCCGGACGCATTCATCCAGTGG CATCCAGTGGGTTGGGAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 46} {0: 1, 1: 0, 2: 2, 3: 23, 4: 224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!