ID: 1142009050_1142009068

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1142009050 1142009068
Species Human (GRCh38) Human (GRCh38)
Location 16:87704492-87704514 16:87704535-87704557
Sequence CCTGAACGTCACGGGGAAGGAGG GAGGGGTCCTGAACGTCACGGGG
Strand - +
Off-target summary {0: 4, 1: 1, 2: 2, 3: 9, 4: 93} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!