ID: 1142029818_1142029825

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1142029818 1142029825
Species Human (GRCh38) Human (GRCh38)
Location 16:87832944-87832966 16:87832962-87832984
Sequence CCTCCGGCAGCCACTCGGCCTCC CCTCCTGGCTATGTCTCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 300} {0: 1, 1: 0, 2: 4, 3: 38, 4: 534}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!