ID: 1142033589_1142033595

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1142033589 1142033595
Species Human (GRCh38) Human (GRCh38)
Location 16:87850499-87850521 16:87850537-87850559
Sequence CCAGAGCGTGCATCCGCCGGGTG AGCTCCACAGCTCCAGGACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 31} {0: 1, 1: 0, 2: 0, 3: 21, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!