ID: 1142047564_1142047567

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1142047564 1142047567
Species Human (GRCh38) Human (GRCh38)
Location 16:87935445-87935467 16:87935472-87935494
Sequence CCGCCGGGTCTGGATGGTGAGTC CAGTGTGTCCCGTGCGAACACGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 0, 3: 1, 4: 48}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!