ID: 1142054586_1142054598

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1142054586 1142054598
Species Human (GRCh38) Human (GRCh38)
Location 16:87985111-87985133 16:87985151-87985173
Sequence CCCGTGTGTGCTGGTGGCTGGCG TGGGCCTCGCCAGGGGGTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 245} {0: 1, 1: 0, 2: 1, 3: 17, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!