ID: 1142071809_1142071819

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1142071809 1142071819
Species Human (GRCh38) Human (GRCh38)
Location 16:88094649-88094671 16:88094698-88094720
Sequence CCTGACGCCTCCAGACACCCCTT TCTTGATGGTTCCTAGAGCCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 12, 4: 173} {0: 2, 1: 0, 2: 0, 3: 19, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!