ID: 1142075558_1142075569

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1142075558 1142075569
Species Human (GRCh38) Human (GRCh38)
Location 16:88115681-88115703 16:88115715-88115737
Sequence CCTTCCATCTGTACTCCCTCTGG CCTTCCAGCCGTACTCCTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 28, 4: 259} {0: 1, 1: 5, 2: 2, 3: 9, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!