ID: 1142140003_1142140010

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1142140003 1142140010
Species Human (GRCh38) Human (GRCh38)
Location 16:88468673-88468695 16:88468686-88468708
Sequence CCCAGGGCCCCGCCCCCCAGAGC CCCCCAGAGCCCCACCCCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 54, 4: 508} {0: 1, 1: 1, 2: 8, 3: 87, 4: 663}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!