ID: 1142141136_1142141151

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1142141136 1142141151
Species Human (GRCh38) Human (GRCh38)
Location 16:88473400-88473422 16:88473444-88473466
Sequence CCCTCTCACCATGGCCTTGAGGG GCCTGTCCTCGAGGGCCGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 204} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!