ID: 1142150195_1142150205

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1142150195 1142150205
Species Human (GRCh38) Human (GRCh38)
Location 16:88509304-88509326 16:88509338-88509360
Sequence CCTATGGGAGCCACAGGGCGGGG GATGGGGCCGATTAGATAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 227} {0: 1, 1: 0, 2: 0, 3: 2, 4: 58}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!