ID: 1142155020_1142155030

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1142155020 1142155030
Species Human (GRCh38) Human (GRCh38)
Location 16:88528995-88529017 16:88529027-88529049
Sequence CCCCGGCCGGGTACAGGAGCCAT CCCAGCACCGTGGGAGGCCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 56} {0: 24, 1: 2119, 2: 124816, 3: 274645, 4: 321426}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!