ID: 1142171555_1142171563

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1142171555 1142171563
Species Human (GRCh38) Human (GRCh38)
Location 16:88625179-88625201 16:88625212-88625234
Sequence CCCCGCTGTTGCTTGTATTACAG AGCGGCAGCGGCAGTGGCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 134} {0: 4, 1: 22, 2: 89, 3: 514, 4: 1807}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!