ID: 1142176615_1142176631

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1142176615 1142176631
Species Human (GRCh38) Human (GRCh38)
Location 16:88648198-88648220 16:88648231-88648253
Sequence CCAGGCCACCCAGAGCTGCCCCC CACAGCACAGTGACAGGGTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 81, 4: 542} {0: 1, 1: 0, 2: 1, 3: 35, 4: 303}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!