ID: 1142188597_1142188607

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1142188597 1142188607
Species Human (GRCh38) Human (GRCh38)
Location 16:88706579-88706601 16:88706604-88706626
Sequence CCCCCGGCGCCGCGGCCCAGGTA AGCTGGCGGCCGGACCCGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 151} {0: 1, 1: 0, 2: 1, 3: 10, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!