ID: 1142196954_1142196958

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1142196954 1142196958
Species Human (GRCh38) Human (GRCh38)
Location 16:88743358-88743380 16:88743376-88743398
Sequence CCGGCACGTGCTGGCAGGAGCTT AGCTTCCGGGCCCTCACCCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 16, 4: 148} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!