ID: 1142239485_1142239493

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1142239485 1142239493
Species Human (GRCh38) Human (GRCh38)
Location 16:88938689-88938711 16:88938730-88938752
Sequence CCATGCTGGGTCTGAACACCCGC GGGCACGCTGAAGTTGCTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 139} {0: 1, 1: 0, 2: 0, 3: 6, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!