ID: 1142305057_1142305063

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1142305057 1142305063
Species Human (GRCh38) Human (GRCh38)
Location 16:89280182-89280204 16:89280202-89280224
Sequence CCAGGGCACCGGCTCCACCTGGC GGCCGAGGTGAGACAGGCCGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 32, 4: 287} {0: 1, 1: 0, 2: 1, 3: 19, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!