ID: 1142328224_1142328232

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1142328224 1142328232
Species Human (GRCh38) Human (GRCh38)
Location 16:89432387-89432409 16:89432410-89432432
Sequence CCGTGGCAGCCGCCTCCCAGAGC CCGTGGCATGCACTGTGTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 347} {0: 1, 1: 0, 2: 0, 3: 12, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!