ID: 1142364831_1142364845

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1142364831 1142364845
Species Human (GRCh38) Human (GRCh38)
Location 16:89644756-89644778 16:89644792-89644814
Sequence CCCACGACACCACTGCAGCCTCA GGGGTGGGCAGGACTGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 2, 3: 17, 4: 200} {0: 1, 1: 0, 2: 12, 3: 106, 4: 1143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!