ID: 1142367514_1142367525

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1142367514 1142367525
Species Human (GRCh38) Human (GRCh38)
Location 16:89657846-89657868 16:89657873-89657895
Sequence CCCGGCTCCGCGGCCGCGGAGGT GGACCCGGGCTTGCGTCGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 139} {0: 1, 1: 0, 2: 0, 3: 1, 4: 39}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!