ID: 1142378888_1142378897

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1142378888 1142378897
Species Human (GRCh38) Human (GRCh38)
Location 16:89720991-89721013 16:89721010-89721032
Sequence CCGGCGACGGGCCCCCTCCGCGC GCGCGTACTGCGGGCCCCACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 193} {0: 1, 1: 0, 2: 0, 3: 4, 4: 33}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!