ID: 1142382233_1142382242

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1142382233 1142382242
Species Human (GRCh38) Human (GRCh38)
Location 16:89739461-89739483 16:89739509-89739531
Sequence CCTGTGGGTGGAGGTACCTGTAA GCTGATCCGGGGCCACACGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 298} {0: 1, 1: 0, 2: 0, 3: 8, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!