ID: 1142408680_1142408688

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1142408680 1142408688
Species Human (GRCh38) Human (GRCh38)
Location 16:89905129-89905151 16:89905142-89905164
Sequence CCCCCTCCTCAGGGACCCTCATC GACCCTCATCCCAGACACGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 376} {0: 1, 1: 0, 2: 1, 3: 10, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!