ID: 1142474700_1142474712

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1142474700 1142474712
Species Human (GRCh38) Human (GRCh38)
Location 17:181813-181835 17:181856-181878
Sequence CCCCGCGCGCGCACACTCGCGGC CTTCCGCTCATGCACGCCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 137} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!