ID: 1142486175_1142486189

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1142486175 1142486189
Species Human (GRCh38) Human (GRCh38)
Location 17:248883-248905 17:248926-248948
Sequence CCACCTGCCTGCCTCCTTCCTGT GGGCGAAGCAACCGAGGCTGAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 14, 3: 209, 4: 1452} {0: 1, 1: 0, 2: 0, 3: 5, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!