ID: 1142496555_1142496567

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1142496555 1142496567
Species Human (GRCh38) Human (GRCh38)
Location 17:309422-309444 17:309466-309488
Sequence CCCCCTGCTGGGGGTCCGGGATA CTCCTGCCAGCCCCCCTGCTGGG
Strand - +
Off-target summary {0: 3, 1: 3, 2: 0, 3: 9, 4: 102} {0: 2, 1: 1, 2: 5, 3: 50, 4: 529}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!