ID: 1142508702_1142508710

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1142508702 1142508710
Species Human (GRCh38) Human (GRCh38)
Location 17:381225-381247 17:381251-381273
Sequence CCCGGAAGCCCTCCTCATGCTTC GAACCCCTCCTCATCCCTCCCGG
Strand - +
Off-target summary {0: 7, 1: 5, 2: 19, 3: 72, 4: 472} {0: 1, 1: 14, 2: 15, 3: 54, 4: 1247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!