|
Left Crispr |
Right Crispr |
Crispr ID |
1142528867 |
1142528877 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:565227-565249
|
17:565276-565298
|
Sequence |
CCCCGTCTTCACTAAAAACACAA |
GCCTGTAATCCCAGCTACTCGGG |
Strand |
- |
+ |
Off-target summary |
{0: 4, 1: 293, 2: 9403, 3: 123953, 4: 231382} |
{0: 72761, 1: 205379, 2: 228437, 3: 173801, 4: 346072} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|