|
Left Crispr |
Right Crispr |
Crispr ID |
1142528875 |
1142528879 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:565258-565280
|
17:565279-565301
|
Sequence |
CCAGGCGTGGTGGCGGGTGCCTG |
TGTAATCCCAGCTACTCGGGAGG |
Strand |
- |
+ |
Off-target summary |
{0: 3523, 1: 23276, 2: 59837, 3: 94548, 4: 145083} |
{0: 44593, 1: 206846, 2: 252437, 3: 185282, 4: 427506} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|