ID: 1142585275_1142585279

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1142585275 1142585279
Species Human (GRCh38) Human (GRCh38)
Location 17:968361-968383 17:968410-968432
Sequence CCGAGCACCTGATTAGTCAAAGA AAAGATACACAGATGCAGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 84} {0: 1, 1: 0, 2: 4, 3: 37, 4: 552}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!