ID: 1142591226_1142591237

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1142591226 1142591237
Species Human (GRCh38) Human (GRCh38)
Location 17:1006933-1006955 17:1006966-1006988
Sequence CCTCCGCCAGCCACGGGCCCGGG GTACCTACGCCATGACGTCATGG
Strand - +
Off-target summary {0: 7, 1: 0, 2: 2, 3: 31, 4: 529} {0: 1, 1: 6, 2: 0, 3: 1, 4: 16}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!