ID: 1142599214_1142599220

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1142599214 1142599220
Species Human (GRCh38) Human (GRCh38)
Location 17:1045081-1045103 17:1045116-1045138
Sequence CCTCAAGAAGGGAAAAGGCACAG GCTTCGGAGGAGCCGGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 304} {0: 1, 1: 0, 2: 0, 3: 24, 4: 372}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!