ID: 1142668492_1142668497

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1142668492 1142668497
Species Human (GRCh38) Human (GRCh38)
Location 17:1475930-1475952 17:1475968-1475990
Sequence CCTGAGCCTTATACACAAGTTCT ATGCATAGAAAAAGGCAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 124} {0: 1, 1: 0, 2: 8, 3: 77, 4: 692}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!