ID: 1142683185_1142683193

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1142683185 1142683193
Species Human (GRCh38) Human (GRCh38)
Location 17:1562210-1562232 17:1562229-1562251
Sequence CCGGGTTGTCCCTCCGTGCCCGT CCGTGGGCCCCTCCATGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 70} {0: 1, 1: 0, 2: 4, 3: 26, 4: 295}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!