ID: 1142696930_1142696935

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1142696930 1142696935
Species Human (GRCh38) Human (GRCh38)
Location 17:1638969-1638991 17:1639003-1639025
Sequence CCTACACATCCTGTCTTTGCTCT TACCCAGAAGCTTCTTCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 311} {0: 1, 1: 0, 2: 1, 3: 18, 4: 245}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!