ID: 1142698415_1142698429

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1142698415 1142698429
Species Human (GRCh38) Human (GRCh38)
Location 17:1645790-1645812 17:1645825-1645847
Sequence CCAGGCCGGAGGGGCGGGCTGCC CCTGAGAGGGAGGGGGTGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 369} {0: 1, 1: 0, 2: 5, 3: 94, 4: 929}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!