ID: 1142698988_1142698991

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1142698988 1142698991
Species Human (GRCh38) Human (GRCh38)
Location 17:1648473-1648495 17:1648488-1648510
Sequence CCGAGCTGCTGCGCGGCCTCCGC GCCTCCGCCTTTGGAAGGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 186} {0: 1, 1: 0, 2: 0, 3: 11, 4: 300}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!