ID: 1142699750_1142699758

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1142699750 1142699758
Species Human (GRCh38) Human (GRCh38)
Location 17:1651676-1651698 17:1651726-1651748
Sequence CCAGGCAGGTGCACGGTCTGGTG GCAGCGGATCTCCTTCACCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 194} {0: 1, 1: 0, 2: 0, 3: 2, 4: 94}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!